View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11497_low_10 (Length: 294)
Name: NF11497_low_10
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11497_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 132 - 286
Target Start/End: Original strand, 9911654 - 9911808
Alignment:
| Q |
132 |
ttttatttcatctggtctagtatcaaatcagaatattttgtcattttagaaagctcttttttagcttttgggaaatggcataaatatgaatttttggaaa |
231 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9911654 |
ttttattccatctggtctagtatcaaatcagaatattttgttattttagaaagctcttttatagcttttgggaaatggcataaatatgaatttttggaaa |
9911753 |
T |
 |
| Q |
232 |
gatatttggcgcggtccttccttatttctctatctcaacgttcctatgaatcaac |
286 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9911754 |
gatatttggtgtggtccttccttatttctctatctcaacattcctatgaatcaac |
9911808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University