View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11497_low_14 (Length: 251)
Name: NF11497_low_14
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11497_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 77 - 241
Target Start/End: Complemental strand, 3980311 - 3980145
Alignment:
| Q |
77 |
aagaataaagaagatgtgatagtcaccatttcttttgatttaaaaatttaaaagagatcaatactttacatggttttatacccatgtggtccgtagtaca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
3980311 |
aagaataaagaagatgtgatagtcaccatttcttttgattaaaaaatttaaaagagatcaatactttacatagttttataaccatgtgctccgtagtaca |
3980212 |
T |
 |
| Q |
177 |
atcttgaagattttatacccagcagcttcctacccc--ttcagtatatcttattctaatccttcttc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3980211 |
atcttgaagattttatacccagcagcttcctaccccctttcagtatatcttattctaatccttcttc |
3980145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 3980824 - 3980749
Alignment:
| Q |
1 |
tgaaagcactcttgattttgaagagtgacctctcgtcgtcggggttacaaccctcgacgactaaggaggtagaaaa |
76 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3980824 |
tgaaggcactcttgattttgaagagtgacctctcgtcgtcggggtcacaaccctcgacgactaaggaggtagaaaa |
3980749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University