View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11497_low_16 (Length: 225)
Name: NF11497_low_16
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11497_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 33938598 - 33938403
Alignment:
| Q |
15 |
gatgaagaacgcgggattcgagcatgttcttagatattttgacgaagatggtgatggaaaggtttcaccagtagagctaagacaaaggctaagaataatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33938598 |
gatgaagaacgcgggattcgagcatgttcttagatattttgacgaagatggtgatggaaaggtttcaccagcagagctaagacaaaggctaagaataatg |
33938499 |
T |
|
| Q |
115 |
ggagaagagattttattgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggaggaattaattgctttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33938498 |
ggagaagagattttattgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggaggaattaattgctttg |
33938403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 33931796 - 33931598
Alignment:
| Q |
12 |
agagatgaagaacgcgggattcgagcatgttcttagatattttgacgaagatggtgatggaaaggtttcaccagtagagctaagacaaaggctaagaata |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33931796 |
agagatgaagaatgcgggattcgagcatgttcttagatattttgacgaagatggtgatggaaaggtttcaccagcagagctaagacaaaggctaagaata |
33931697 |
T |
|
| Q |
112 |
atgggagaagagattttattgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggaggaattaattgctttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33931696 |
atgggagaagagattttattgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggaggaattaattgctttg |
33931598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 193
Target Start/End: Complemental strand, 42846905 - 42846841
Alignment:
| Q |
129 |
attgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttgg |
193 |
Q |
| |
|
||||||||||| |||||| |||||||| ||| ||||||| ||||||||||| | |||||||||| |
|
|
| T |
42846905 |
attgaaagaagttgaaattgctattgaggcattggattctgatggtgatgggttattgagtttgg |
42846841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Complemental strand, 42840097 - 42840029
Alignment:
| Q |
129 |
attgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggagga |
197 |
Q |
| |
|
||||||||||| || || |||||||| ||| ||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
42840097 |
attgaaagaagtggagattgctattgaggcattggattctgatggtgatgggttattgagtttggagga |
42840029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Complemental strand, 42849892 - 42849824
Alignment:
| Q |
129 |
attgaaagaagctgaaatggctattgaagcaatggattcagatggtgatggttatttgagtttggagga |
197 |
Q |
| |
|
||||||||||| ||||| || ||||| ||| ||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
42849892 |
attgaaagaagtggaaattgcaattgaggcattggattctgatggtgatggattattgagtttggagga |
42849824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University