View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11497_low_4 (Length: 427)

Name: NF11497_low_4
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11497_low_4
NF11497_low_4
[»] chr4 (2 HSPs)
chr4 (8-165)||(41101145-41101302)
chr4 (341-411)||(41101304-41101374)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 41101145 - 41101302
Alignment:
8 gcatgtggaaccaggagaaaggatctttgacatggctgatagcaaccattgagtccaagtagataatccctctttgcaccagcttcaaaccattgaagac 107  Q
    |||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41101145 gcatatggaaccaggaggaaggatctttgacatggctgatagcacccattgagtccaagtagataatccctctttgcaccagcttcaaaccattgaagac 41101244  T
108 aaccagaagctcagcattgagattgttagaatggtcaatgtggcccaagaatcccaca 165  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
41101245 aaccagaagctcagcattgagatttttagaatggtcaatgcggcccaagaatcccaca 41101302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 341 - 411
Target Start/End: Original strand, 41101304 - 41101374
Alignment:
341 aattgggtaattagagttgccccatcagtatgaagaaattcattcctaggatcatggtatggtaaatgact 411  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
41101304 aattgggtaattagagttaccccatcagtatgaagaaattcattcctaggatcatggtatggtaaatgact 41101374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University