View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11497_low_8 (Length: 321)

Name: NF11497_low_8
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11497_low_8
NF11497_low_8
[»] chr7 (2 HSPs)
chr7 (27-253)||(3980852-3981078)
chr7 (275-321)||(3980806-3980852)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 253
Target Start/End: Complemental strand, 3981078 - 3980852
Alignment:
27 cggttgctgtcgagtttgagggaatacacgtgccttaacctcattaagaaattagggataggtccggagaggttagggttaatgttgaggattaaggtct 126  Q
    |||||| ||||||||||||||| || || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3981078 cggttgttgtcgagtttgagggtatgcatgtgtcttaacctcattaagaaattagggataggtccggagaggttagggttaatgttgaggattaaggtct 3980979  T
127 atgggtatgtgagctctggaatggatgctgggattttgccgacgattttgttcgagctaaaaatcgcgaggatgttgacacgagaggacatggttttcag 226  Q
    ||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
3980978 atgggtacgtgagctctggaatggatgctgggatttcgcccacgattttgttcgagctgaaaatcgtgaggatgttgacacgagaggacatggttttcag 3980879  T
227 aattatcttgcattgcaaattgatcca 253  Q
    |||||||||||||||||||||||||||    
3980878 aattatcttgcattgcaaattgatcca 3980852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 275 - 321
Target Start/End: Complemental strand, 3980852 - 3980806
Alignment:
275 atccatgtagagaagtagctgacattgttgaaagcactcttgatttt 321  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
3980852 atccatgtagagaagtagctgacattgttgaaggcactcttgatttt 3980806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University