View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11497_low_8 (Length: 321)
Name: NF11497_low_8
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11497_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 253
Target Start/End: Complemental strand, 3981078 - 3980852
Alignment:
| Q |
27 |
cggttgctgtcgagtttgagggaatacacgtgccttaacctcattaagaaattagggataggtccggagaggttagggttaatgttgaggattaaggtct |
126 |
Q |
| |
|
|||||| ||||||||||||||| || || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981078 |
cggttgttgtcgagtttgagggtatgcatgtgtcttaacctcattaagaaattagggataggtccggagaggttagggttaatgttgaggattaaggtct |
3980979 |
T |
 |
| Q |
127 |
atgggtatgtgagctctggaatggatgctgggattttgccgacgattttgttcgagctaaaaatcgcgaggatgttgacacgagaggacatggttttcag |
226 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3980978 |
atgggtacgtgagctctggaatggatgctgggatttcgcccacgattttgttcgagctgaaaatcgtgaggatgttgacacgagaggacatggttttcag |
3980879 |
T |
 |
| Q |
227 |
aattatcttgcattgcaaattgatcca |
253 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3980878 |
aattatcttgcattgcaaattgatcca |
3980852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 275 - 321
Target Start/End: Complemental strand, 3980852 - 3980806
Alignment:
| Q |
275 |
atccatgtagagaagtagctgacattgttgaaagcactcttgatttt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3980852 |
atccatgtagagaagtagctgacattgttgaaggcactcttgatttt |
3980806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University