View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11498_high_2 (Length: 466)
Name: NF11498_high_2
Description: NF11498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11498_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 6e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 77 - 321
Target Start/End: Original strand, 34628142 - 34628374
Alignment:
| Q |
77 |
ttatagaaatgcacttattatctaggacatgannnnnnnnnnnggacgaaagctatttcaaccaaactaaggataactgattcattctcaagtatatagt |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628142 |
ttatagaaatgcacttattatttaggacatgatttttttttt-ggaagaaagctatttcaaccaaactaaggataactgattcattctcaagtatatagt |
34628240 |
T |
|
| Q |
177 |
tcgaggatatttaagatcaaaaacagagtcaaagctcggcagaactggacatatgtgagtctttgaaggtctcggtctaagttaaagttgtggaattgaa |
276 |
Q |
| |
|
|| ||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628241 |
tcaaggatctttaagatcaaaaa----------gctcggcagaactggacatatgtgagtctt-gaaggtctcggtctaagttaaagttgtggaattgaa |
34628329 |
T |
|
| Q |
277 |
caatgaagcatcaaacacacacttattgttggcagtgtcattaac |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628330 |
caatgaagcatcaaacacacacttattgttggcagtgtcattaac |
34628374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University