View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11498_high_4 (Length: 386)
Name: NF11498_high_4
Description: NF11498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11498_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 102 - 369
Target Start/End: Complemental strand, 11000576 - 11000309
Alignment:
| Q |
102 |
tcgttcactcttgaaaattttcaagccctaccgttggagaactaaagtccatcagagcttgagctaaagcatcattactcaatgcatgagtgactcttcc |
201 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000576 |
tcgtccactcttcaaaattttcaagccctaccgtcggagaactaaagtccatcagagcttgagctaaagcatcattactcaatgcatgagtgactcttcc |
11000477 |
T |
|
| Q |
202 |
ccgaagattggcgctgtgggcaaccgagtagttatcgttggcgtgccacttcaatccttggtgatccaacatgcgggtatgggaatcattggacccaaca |
301 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000476 |
ccgtagattggcgctttgggcaaccgagtagttatcgttggcgtgccacttcaatccttggtgatccaacatgcgggtatgggaatcattggacccaaca |
11000377 |
T |
|
| Q |
302 |
ctgctgttattggtaccctcaccaaacatggtattactcttgttgagatctattggaaacattctttt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11000376 |
ctgctgttattggtaccctcaccaaacatggtattactcttgttgagatctattggaaacattctttt |
11000309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11000614 - 11000711
Alignment:
| Q |
1 |
gcaaggatcttttgggaaactctaccgaggtacttacaacggggaggatgtcgctatcaaaatcttggagaggactgaaaatgatagggcacaggttc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11000614 |
gcaaggatcttttgggaaactctaccgaggtacttacaacggggaggatgtcgctatcaaaatcttggagaggactgagaatgatagggcacaggttc |
11000711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 107 - 311
Target Start/End: Original strand, 42404031 - 42404235
Alignment:
| Q |
107 |
cactcttgaaaattttcaagccctaccgttggagaactaaagtccatcagagcttgagctaaagcatcattactcaatgcatgagtgactcttccccgaa |
206 |
Q |
| |
|
||||||| ||||||||||||||| | || |||||| || ||||||||||||||||||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
42404031 |
cactcttcaaaattttcaagcccctcagtcggagaattattgtccatcagagcttgagctaaagcatcgtcgctcaatgcatgagtaactcttccccgac |
42404130 |
T |
|
| Q |
207 |
gattggcgctgtgggcaaccgagtagttatcgttggcgtgccacttcaatccttggtgatccaacatgcgggtatgggaatcattggacccaacactgct |
306 |
Q |
| |
|
||||||||||||| ||||| || |||||||| ||||| ||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42404131 |
gattggcgctgtgtgcaacagaatagttatcattggcacgcctcttcaacccttgatgatccaacatgcgggtatgggaatcattggacccaacactgct |
42404230 |
T |
|
| Q |
307 |
gttat |
311 |
Q |
| |
|
||||| |
|
|
| T |
42404231 |
gttat |
42404235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 2 - 86
Target Start/End: Complemental strand, 42403987 - 42403903
Alignment:
| Q |
2 |
caaggatcttttgggaaactctaccgaggtacttacaacggggaggatgtcgctatcaaaatcttggagaggactgaaaatgata |
86 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42403987 |
caaggagcttttgggaaactctacagaggtacttacaacggggaggatgtcgctatcaaaatcttggagagacctgaaaatgata |
42403903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University