View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11498_low_16 (Length: 226)
Name: NF11498_low_16
Description: NF11498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11498_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 3304050 - 3303860
Alignment:
| Q |
1 |
tgcattgaaggacggcgtaccattgagttggggaggtattttaattactcacaaatcctttaatttatataagctataattcgcaatcctatttaaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3304050 |
tgcattgaaggacggcgtaccattgagttggggaggtattttaattactcacaaatcctttaatttatataagctataattcgcaaccctatttaaatct |
3303951 |
T |
 |
| Q |
101 |
taactcgatcctatgtcacttgcgcgcatctatcaataaccactcttggttgtacatttctcttcttgaatagaacacttagccgcaatct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303950 |
taactcgatcctatgtcacttgcgcgcatctatcaataaccactcttggttgtacatttctcttcttgaatagaacacttagccgcaatct |
3303860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 206
Target Start/End: Original strand, 32860227 - 32860335
Alignment:
| Q |
98 |
tcttaactcgatcctatgtcacttgcgcgcatctatcaataaccactcttggttgtacatttctcttcttgaatagaacacttagccgcaatctcttcta |
197 |
Q |
| |
|
|||||||| | |||||||| | |||| | ||||||||||||| ||||||||||||||| |||||||||| ||||||| ||||| | | ||||||| | |
|
|
| T |
32860227 |
tcttaacttggtcctatgttatttgcatgaatctatcaataactactcttggttgtacagttctcttctttaatagaagacttaacttccatctcttaca |
32860326 |
T |
 |
| Q |
198 |
gaaatgtat |
206 |
Q |
| |
|
||||||||| |
|
|
| T |
32860327 |
gaaatgtat |
32860335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University