View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11499_high_12 (Length: 339)
Name: NF11499_high_12
Description: NF11499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11499_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 116 - 329
Target Start/End: Original strand, 226078 - 226291
Alignment:
| Q |
116 |
tggagatgatgttgcttttttaccacctaaccaccaatgattttaattttagccaaaactagaaaagcaatactacaatctattttaattttaccatcca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226078 |
tggagatgatgttgcttttttaccacctaaccaccaatgattttaattttagccaaaactagaaaagcaatactacaatctattttaattttaccatcca |
226177 |
T |
 |
| Q |
216 |
tagtgtacttgctggtccataggttgcagtaatggatgggttcccatattttggctgccagccccatcaccttcctcattatccagaatcagaatcacat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226178 |
tagtgtacttgctggtccataggttgcagtaatggatgggttcccatattttggctgccagccccatcaccttcctcattatccagaatcagaatcacat |
226277 |
T |
 |
| Q |
316 |
tcttctatcttcat |
329 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
226278 |
tcttctatcttcat |
226291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 233579 - 233640
Alignment:
| Q |
25 |
catgtggtcattatcatgatttatg--atacgaaggacattggttggttggttaacaattga |
84 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
233579 |
catgtggtcattattatgatttatgtgatacgaaggacattggttggttggttaacaattga |
233640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University