View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11499_high_22 (Length: 240)
Name: NF11499_high_22
Description: NF11499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11499_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 55161381 - 55161583
Alignment:
| Q |
19 |
aattactagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaatattcaattcaattcaattcaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55161381 |
aattactagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaat-----attcaattcaattcaatt |
55161475 |
T |
|
| Q |
119 |
catgttgttgttgttttgtaacttataa-ttgtagtattcttctatatgacagacaaatgtcatatatagaactgacatgcatagttgagac-tttgaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55161476 |
catgttgttgttgttttgtaacttataacttgtagtattcttctatatgacagacaaatgtcatatatagaactgacatgcatagttgagacttttgaca |
55161575 |
T |
|
| Q |
217 |
gtgcaaag |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
55161576 |
gtgcaaag |
55161583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University