View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11499_low_13 (Length: 316)
Name: NF11499_low_13
Description: NF11499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11499_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 6833393 - 6833679
Alignment:
| Q |
18 |
cttttcactgtctcaaaataattgtcactttagaataatgacaccgtggttttgttaaggcttcagaatttcattagtcctaatgttcatttttaattta |
117 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6833393 |
cttttcactgtttcaaaataattgtcattttagaataatgacaccgtagttttgttaaggcttcagaatttcattagtcctaatgttcatttttaattta |
6833492 |
T |
|
| Q |
118 |
cctgacctttgggtgttatggatagtatattgaaagataccgaagtatgggatggttagactctgaggtttcatttgatggaaacaaaacattgataagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6833493 |
cctgacctttgggtgttatggatagtatattgaaagataccgaagtatgggatggttagactctgaggtttcatttgatggaaacaaaacattgataagt |
6833592 |
T |
|
| Q |
218 |
tttggacccaagctactgtccacaatgttcttccaactcagtcccagagaggtatctttatggcatctaatcttgtagcttcatctc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6833593 |
tttggacccaagctactgtccacaatgttcttccaactcagtcccagagaggtatctttatggcatctaatcttgtagcttcatctc |
6833679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 41492189 - 41492217
Alignment:
| Q |
26 |
tgtctcaaaataattgtcactttagaata |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41492189 |
tgtctcaaaataattgtcactttagaata |
41492217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 30192177 - 30192214
Alignment:
| Q |
19 |
ttttcactgtctcaaaataattgtcactttagaataat |
56 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
30192177 |
ttttctctgtcttaaaataattgtcactttagaataat |
30192214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 12736756 - 12736728
Alignment:
| Q |
25 |
ctgtctcaaaataattgtcactttagaat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12736756 |
ctgtctcaaaataattgtcactttagaat |
12736728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 30710580 - 30710608
Alignment:
| Q |
26 |
tgtctcaaaataattgtcactttagaata |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30710580 |
tgtctcaaaataattgtcactttagaata |
30710608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 38795275 - 38795303
Alignment:
| Q |
26 |
tgtctcaaaataattgtcactttagaata |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38795275 |
tgtctcaaaataattgtcactttagaata |
38795303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University