View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11499_low_22 (Length: 240)

Name: NF11499_low_22
Description: NF11499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11499_low_22
NF11499_low_22
[»] chr3 (1 HSPs)
chr3 (19-224)||(55161381-55161583)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 55161381 - 55161583
Alignment:
19 aattactagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaatattcaattcaattcaattcaatt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||    
55161381 aattactagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaat-----attcaattcaattcaatt 55161475  T
119 catgttgttgttgttttgtaacttataa-ttgtagtattcttctatatgacagacaaatgtcatatatagaactgacatgcatagttgagac-tttgaca 216  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
55161476 catgttgttgttgttttgtaacttataacttgtagtattcttctatatgacagacaaatgtcatatatagaactgacatgcatagttgagacttttgaca 55161575  T
217 gtgcaaag 224  Q
    ||||||||    
55161576 gtgcaaag 55161583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University