View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1149_high_55 (Length: 382)

Name: NF1149_high_55
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1149_high_55
NF1149_high_55
[»] chr1 (1 HSPs)
chr1 (49-254)||(40695325-40695529)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 49 - 254
Target Start/End: Complemental strand, 40695529 - 40695325
Alignment:
49 agtttgcaaatgtcaattttcagccacatttgatgcatgtcgctttaaccatagaaaggttgaaaatgatgcatgttttagtgtcaacatcatgcaattg 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40695529 agtttgcaaatgtcaattttcagccacatttgatgcatgtcgctttaaccatagaaaggttgaaaatgatgcatgttttagtgtcaacatcatgcaattg 40695430  T
149 caaggtcgtcttgattgcaatatgattactagtacataactttttacaacttaatttcatgctttcatgcagggcccaatcattaatttatccaaaatgt 248  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||  |    
40695429 caaggtcgtcttgattgcaatatgattactagtacat-actttttacaacttaatttcatgctttcatgccgggcccgatcattaatttatgcaaaaaat 40695331  T
249 caagat 254  Q
    ||||||    
40695330 caagat 40695325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University