View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_high_68 (Length: 341)
Name: NF1149_high_68
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_high_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 31 - 269
Target Start/End: Complemental strand, 6122251 - 6122013
Alignment:
| Q |
31 |
attatgctgactgattgtttcgttttatttgtaaggaataggctacaataatgtgatgcttgtccattttccctttagggttggttagagcatatattcg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6122251 |
attatgctgactgattgtttcgttttatttgtaaggaataggctacaataatgtgatgcttgtccattttccctttagggttggttagagcatatattcg |
6122152 |
T |
 |
| Q |
131 |
atttggataaaataaggaatttactccttagtccctccacttccattattaaaatatatgccccctcccaatgtcatattatctataattagtaaaacaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6122151 |
atttggataaaataaggaatttactccttagtccctccacttccattattaaaatatatgccccctctcaatgtcatattatctataattagtaaaacaa |
6122052 |
T |
 |
| Q |
231 |
aatcatattatctatatacatccgttaagcaacttgtac |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6122051 |
aatcatattatctatatacatccgttaagcaacttgtac |
6122013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University