View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_high_70 (Length: 339)
Name: NF1149_high_70
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_high_70 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 65 - 339
Target Start/End: Complemental strand, 2833638 - 2833364
Alignment:
| Q |
65 |
tttattgttttagttggtggagtagttgtttgggagagatgaaaatgattaagagcttatttgaaacgtgagttttgtgatgtgaagtgaagatgtttcg |
164 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833638 |
tttagtgttttagttggtggagtaattgtttgggagagatgaaaatgattaagagcttatttgaaacgtgagttttgtgatgtgaagtgaagatgtttcg |
2833539 |
T |
 |
| Q |
165 |
ttcttcaaaatggagaagtgagaagaataggattaaagctgtttttaagcttcaattcaatgctactaaggtaggttcatctcagaatttttgtatattc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833538 |
ttcttcaaaatggagaagtgagaagaataggattaaagctgtttttaagcttcaattcaatgctactaaggtaggttcatctcagaatttttgtatattc |
2833439 |
T |
 |
| Q |
265 |
attttctttactttcatatttctcagaatgaataatctaatgtattggttctgttaggttctgagggttttgata |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833438 |
attttctttactttcatatttctcagaatgaataatctaatgtattggttctgttaggttctgagggttttgata |
2833364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University