View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_high_90 (Length: 272)
Name: NF1149_high_90
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_high_90 |
 | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 29 - 262
Target Start/End: Original strand, 8435018 - 8435249
Alignment:
| Q |
29 |
aaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactgcacaattcggaaccattggcaactc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8435018 |
aaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactacacaattcggaaccattggcaacta |
8435117 |
T |
|
| Q |
129 |
atcaccatgaggaccactcagagatagagacactacagtttcttcgtttaattttcattgcagcgtcacatttttagatcatcgacaaatttaccattag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
8435118 |
atcaccatgaggaccactcagagatagagacattacagtttcttcgtttaattttcattgcagc--cacatttttagatcatcgacaaagttaccattag |
8435215 |
T |
|
| Q |
229 |
aattatataatattgctatcattttcggcctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8435216 |
aattatataatattgctatcattttcggcctttg |
8435249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 67
Target Start/End: Complemental strand, 75405 - 75367
Alignment:
| Q |
29 |
aaataggcatttgcataaatcactaatgtgtagacaaaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75405 |
aaataggcatttgcataaatcactaatgtgtagacaaaa |
75367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University