View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_102 (Length: 293)
Name: NF1149_low_102
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_102 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 40195728 - 40195617
Alignment:
| Q |
99 |
gttttaaatcttcagtttgtatgttttacgaatggaagtggaacccgaaggattgtcttttgcgataattagttgtttgggttttaagggttttgtagtg |
198 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
40195728 |
gttttaaatcttcgatttgtatgttttaagaatggaagtggaacccgaaggattgtcttttgcgataattggctgtttgggttttaagggttttgtagtg |
40195629 |
T |
 |
| Q |
199 |
gtttggcagtag |
210 |
Q |
| |
|
||||| |||||| |
|
|
| T |
40195628 |
gtttgacagtag |
40195617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 160
Target Start/End: Original strand, 52867287 - 52867332
Alignment:
| Q |
115 |
ttgtatgttttacgaatggaagtggaacccgaaggattgtcttttg |
160 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
52867287 |
ttgtatgttttatgaatggtagtggaacccgagtgattgtcttttg |
52867332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 46351 - 46291
Alignment:
| Q |
102 |
ttaaatcttcagtttgtatgttttacgaatggaagtggaacccgaaggattgtcttttgcg |
162 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
46351 |
ttaaagcttcggtttgtatgttttacgaatggaagtggaatccgaaggattgccttttgcg |
46291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 156
Target Start/End: Complemental strand, 43280420 - 43280378
Alignment:
| Q |
114 |
tttgtatgttttacgaatggaagtggaacccgaaggattgtct |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43280420 |
tttgtatgctttacgaatggaagtggaatccgaaggcttgtct |
43280378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 10537633 - 10537597
Alignment:
| Q |
113 |
gtttgtatgttttacgaatggaagtggaacccgaagg |
149 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
10537633 |
gtttgtatgctttacgaatggaagtggaatccgaagg |
10537597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 10682323 - 10682287
Alignment:
| Q |
113 |
gtttgtatgttttacgaatggaagtggaacccgaagg |
149 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
10682323 |
gtttgtatgctttacgaatggaagtggaatccgaagg |
10682287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University