View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1149_low_103 (Length: 291)

Name: NF1149_low_103
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1149_low_103
NF1149_low_103
[»] chr1 (2 HSPs)
chr1 (99-210)||(40195617-40195728)
chr1 (115-160)||(52867287-52867332)
[»] scaffold0013 (1 HSPs)
scaffold0013 (102-162)||(46291-46351)
[»] chr3 (3 HSPs)
chr3 (114-156)||(43280378-43280420)
chr3 (113-149)||(10537597-10537633)
chr3 (113-149)||(10682287-10682323)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 40195728 - 40195617
Alignment:
99 gttttaaatcttcagtttgtatgttttacgaatggaagtggaacccgaaggattgtcttttgcgataattagttgtttgggttttaagggttttgtagtg 198  Q
    |||||||||||||  ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||    
40195728 gttttaaatcttcgatttgtatgttttaagaatggaagtggaacccgaaggattgtcttttgcgataattggctgtttgggttttaagggttttgtagtg 40195629  T
199 gtttggcagtag 210  Q
    ||||| ||||||    
40195628 gtttgacagtag 40195617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 160
Target Start/End: Original strand, 52867287 - 52867332
Alignment:
115 ttgtatgttttacgaatggaagtggaacccgaaggattgtcttttg 160  Q
    |||||||||||| |||||| ||||||||||||  ||||||||||||    
52867287 ttgtatgttttatgaatggtagtggaacccgagtgattgtcttttg 52867332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 46351 - 46291
Alignment:
102 ttaaatcttcagtttgtatgttttacgaatggaagtggaacccgaaggattgtcttttgcg 162  Q
    ||||| |||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||    
46351 ttaaagcttcggtttgtatgttttacgaatggaagtggaatccgaaggattgccttttgcg 46291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 114 - 156
Target Start/End: Complemental strand, 43280420 - 43280378
Alignment:
114 tttgtatgttttacgaatggaagtggaacccgaaggattgtct 156  Q
    |||||||| ||||||||||||||||||| ||||||| ||||||    
43280420 tttgtatgctttacgaatggaagtggaatccgaaggcttgtct 43280378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 10537633 - 10537597
Alignment:
113 gtttgtatgttttacgaatggaagtggaacccgaagg 149  Q
    ||||||||| ||||||||||||||||||| |||||||    
10537633 gtttgtatgctttacgaatggaagtggaatccgaagg 10537597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 10682323 - 10682287
Alignment:
113 gtttgtatgttttacgaatggaagtggaacccgaagg 149  Q
    ||||||||| ||||||||||||||||||| |||||||    
10682323 gtttgtatgctttacgaatggaagtggaatccgaagg 10682287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University