View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_111 (Length: 269)
Name: NF1149_low_111
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_111 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 1718431 - 1718632
Alignment:
| Q |
1 |
atatatataaacagtgtctgtgttaataaaattatatt-agaagaactttgtataactgatgtaatatatagtccgatggtgctccgaagtgtccctaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718431 |
atatatataaacagtgtctgtgttaataaaattatatttagaagaactttgtataactgatgtaatatatagtccgatggtgctccgaagtgtccctaga |
1718530 |
T |
|
| Q |
100 |
aagcttttggcttttcatttcaagctttcctgctttagctcgatcagttgcagagtatattgcattgagcaagtcgccatatgtcaatttaggcctttgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718531 |
aagcttttggcttttcatttcaagctttcctgctttagctcgatcggttgcagagtaaattgcattgagcaagtcgccatatgtcaatttaggcctttgt |
1718630 |
T |
|
| Q |
200 |
tt |
201 |
Q |
| |
|
|| |
|
|
| T |
1718631 |
tt |
1718632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University