View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_118 (Length: 253)
Name: NF1149_low_118
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_118 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 23523295 - 23523532
Alignment:
| Q |
10 |
aacaatatgaaaaaatgataaatattctcggatcatcatcatcattattattattattgttggtacattttcatcgattattctttggattgccaacaat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23523295 |
aacaatatgaaaaaatgataaatattctcggatca---tcatcatcattattattattattggtacatttacatcgattattctttggattgccaacaat |
23523391 |
T |
|
| Q |
110 |
cacaattgcaacctaaaaacatttctgaatggatttagagcagacggctcaaattttaatacagnnnnnnnnnnnnncttaatatgaaaatattgacctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23523392 |
cacaattgcaacctaaaaacatttctgaatggatttagaacagacggctcaaattttaatacag---ttttttttttcttaatatgaaaatattgacctt |
23523488 |
T |
|
| Q |
210 |
aaactattaactgtccgactttgatcggacagataagattttat |
253 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
23523489 |
aaactatgaactgtctgactttgatcggacggataagattttat |
23523532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University