View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_124 (Length: 248)
Name: NF1149_low_124
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_124 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 30 - 245
Target Start/End: Complemental strand, 34820174 - 34819959
Alignment:
| Q |
30 |
gcgtctcctttaaagaagaaagggaagagtgataaaggcgagacaaacaagaagaatgatgatagcatttgtacaaagccaccagttgagaaaagagtta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
34820174 |
gcgtctcctttaaagaagaaagggaagagtgataaaggcgagacaaccaagaagaatgatggtagtatttgtacaaagccaccagctgagaaaagagtta |
34820075 |
T |
 |
| Q |
130 |
gctgccaagaacataaaggaacgagaataaatgtgtttagtgcaaaagcaataagcagatctaagtctgactcagaaatctttgctggaagttttattga |
229 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| || ||||| |||||||| ||||||||||| ||||| |||||| |||| |
|
|
| T |
34820074 |
gctgccaagaacataaaggaatgagactaaatgtgtttagtgcaaaagcaattagaagatccaagtctgaatcagaaatcttggctgggagttttgttga |
34819975 |
T |
 |
| Q |
230 |
cgagagtatcaccaaa |
245 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34819974 |
cgagagtatcaccaaa |
34819959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 87
Target Start/End: Complemental strand, 34819893 - 34819841
Alignment:
| Q |
35 |
tcctttaaagaagaaagggaagagtgataaaggcgagacaaacaagaagaatg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
34819893 |
tcctttaaagaagaaagggaagagtgataaaggcgaggccaacaagaagaatg |
34819841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 159
Target Start/End: Complemental strand, 34835164 - 34835101
Alignment:
| Q |
96 |
atttgtacaaagccaccagttgagaaaagagttagctgccaagaacataaaggaacgagaataa |
159 |
Q |
| |
|
|||||||||||| | || || |||||||||||||| || || ||||||||||||| |||||||| |
|
|
| T |
34835164 |
atttgtacaaagacgccggtcgagaaaagagttaggtgtcatgaacataaaggaatgagaataa |
34835101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University