View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_125 (Length: 223)
Name: NF1149_low_125
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_125 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 17280084 - 17279881
Alignment:
| Q |
1 |
aattaaaacagtactacttataatataaaataggaaaatgctaacgagtgtctctgagacactttaaaaaccttaaaaattaggtttttatgcgaagttc |
100 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||||| | ||| ||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
17280084 |
aattaaaattgtactacctataatataaaatagaaaaatgctaacgagggcctccagaacactct-------ttaaaagttaggtttttatgcgaagttc |
17279992 |
T |
|
| Q |
101 |
cgatattttgggggcatgagggactacctgatttagatcataataatgatcagtttcacttgcttgtgaaagtcttttgttgtgtaaaggttgaagttct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17279991 |
cgttattttgggggcatgagggactacctgatttagatcataataatgatcagtttcacttgcttgtgaaagtcttttgttgtgtaaaggttgaagttct |
17279892 |
T |
|
| Q |
201 |
tgattgatatt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
17279891 |
tgattgatatt |
17279881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University