View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_64 (Length: 382)
Name: NF1149_low_64
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 49 - 254
Target Start/End: Complemental strand, 40695529 - 40695325
Alignment:
| Q |
49 |
agtttgcaaatgtcaattttcagccacatttgatgcatgtcgctttaaccatagaaaggttgaaaatgatgcatgttttagtgtcaacatcatgcaattg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40695529 |
agtttgcaaatgtcaattttcagccacatttgatgcatgtcgctttaaccatagaaaggttgaaaatgatgcatgttttagtgtcaacatcatgcaattg |
40695430 |
T |
|
| Q |
149 |
caaggtcgtcttgattgcaatatgattactagtacataactttttacaacttaatttcatgctttcatgcagggcccaatcattaatttatccaaaatgt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||| | |
|
|
| T |
40695429 |
caaggtcgtcttgattgcaatatgattactagtacat-actttttacaacttaatttcatgctttcatgccgggcccgatcattaatttatgcaaaaaat |
40695331 |
T |
|
| Q |
249 |
caagat |
254 |
Q |
| |
|
|||||| |
|
|
| T |
40695330 |
caagat |
40695325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University