View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_75 (Length: 351)
Name: NF1149_low_75
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 96 - 339
Target Start/End: Original strand, 47183770 - 47184013
Alignment:
| Q |
96 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatttatattgcctta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47183770 |
agatcacaccagccgtcatagtatcttgcattatggctgctttcggtggtcttatgtttggttatgatattggtatttcaggtacatttatatagcctta |
47183869 |
T |
 |
| Q |
196 |
ttctaaaggtttttgttctgattttgtatttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183870 |
ttctaaaggtttttgttctgattttgtacttatacgttcttatgatattggtaacttgagatcaaattctaactagatcaatctatgttcaaattttatt |
47183969 |
T |
 |
| Q |
296 |
tatcttatgaccaaaactccataatacctaaaaccatttacctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47183970 |
tatcttatgaccaaaactccataatacctaaaaccatttacctt |
47184013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 47196681 - 47196745
Alignment:
| Q |
119 |
tcttgcattatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggtacatt |
183 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
47196681 |
tcttgcatcatggctgctactggtggtcttatgtttggttatgatgttggtatttcaggtacatt |
47196745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 751544 - 751491
Alignment:
| Q |
125 |
attatggctgctttcggtggtcttatgtttgggtatgatattggtatttcaggt |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||| ||||| |||||||| |
|
|
| T |
751544 |
attatggctgctaccggtggtcttatgttcggttatgatgttggtgtttcaggt |
751491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University