View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_78 (Length: 348)
Name: NF1149_low_78
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 6626048 - 6625795
Alignment:
| Q |
1 |
tttctctttctcatctggcatccctgaaacatattttcattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626048 |
tttctctttctcatctggcatctctgaaacatattttcattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatga |
6625949 |
T |
|
| Q |
101 |
tccaaaatctgccgagagtataaagcagttagaacaggttttcatccatcacttggttgttaatgctgtttatttattatctgtatggtgtatgaagtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6625948 |
tccaaaatctgccgagagtataaagcagttagaacaggttttcatccatcacttggttgttaatgctgtttatttattatatgtatggtgtatgaagtat |
6625849 |
T |
|
| Q |
201 |
gtacatttaaattcactatctgttttatttgttctgtctgttggtgtggacact |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6625848 |
gtacatttaaattcactatctgttttatttgttctgtctgttggtgtggacact |
6625795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University