View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_86 (Length: 339)
Name: NF1149_low_86
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 5227807 - 5227573
Alignment:
| Q |
9 |
caacaatatcaagtggtctcaactagttggaacaagggggtgcaatctcaggagagtagtggtgtgacaaagcaatcaggtttgttggaattgaatttgt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5227807 |
caacaaaatcaagtggtctcaactagttggaacaagggggtgcaatctcaggagagtagtggtgtgacaaagcaatcaggtttgttggaattgaatttgt |
5227708 |
T |
 |
| Q |
109 |
cttcaccatcttctcagagttggtggtcttcactctcatgaagctaagaacagaacagtgaccgattgattaagacatggctgttgcatgttacattaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5227707 |
cttcaccatcttctcagagttggtggtcttcactctcatgaagctaagaacagaacagtgaccgattgattaagacatggctgttgcatgttacattaca |
5227608 |
T |
 |
| Q |
209 |
attatacattgttatgcttttttggatttgattaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5227607 |
attatacattgttatgcttttttggatttgattaa |
5227573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University