View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1149_low_97 (Length: 302)
Name: NF1149_low_97
Description: NF1149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1149_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 6123807 - 6123706
Alignment:
| Q |
1 |
ttcataaaataaatagaaaactagtaagaaaagggtatactattttattttagtttttggtcaaggaaaagga--tatagtattaattaatttaattttc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6123807 |
ttcataaaataaatagaaaactagtaagaaaagggtatactattttattttagtttttggtcaaggaaaaggatatatagtattaattaatttaattttc |
6123708 |
T |
 |
| Q |
99 |
ac |
100 |
Q |
| |
|
|| |
|
|
| T |
6123707 |
ac |
6123706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 6123630 - 6123592
Alignment:
| Q |
176 |
agttgtcattaggtatcaatcaattgatgctatacgaaa |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6123630 |
agttgtcattaggtatcgatcaattgatgctatacgaaa |
6123592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University