View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_high_20 (Length: 411)
Name: NF11500_high_20
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 3 - 73
Target Start/End: Original strand, 21947585 - 21947655
Alignment:
| Q |
3 |
aattttgaagtagaagcgtaatggaccaacaggaaaataatttctaggaaatcaatcaaatgcataagtag |
73 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21947585 |
aattttcaagtagaagcgtaatggaccagcagaaaaataatttctaggaaatcaatcaaatgcataagtag |
21947655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University