View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_high_28 (Length: 341)
Name: NF11500_high_28
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 91 - 328
Target Start/End: Original strand, 38325284 - 38325521
Alignment:
| Q |
91 |
gcaaattctaattggctaggtttaagaacaatgacggtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacaaatttaagaaaattc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38325284 |
gcaaattctaattggctaggtttaagaacaatgactgtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacagatttaagaaaattc |
38325383 |
T |
 |
| Q |
191 |
aatgaataagtagctatagtatcctctgttgctctcttcctatgtgattgagttttatttctatccaagttattttcatacaattatgtttgaattcact |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38325384 |
aatgaataagtagctatagtatcctctgttgctctcttcctatgtgattgagttttatttcaatcgaagttattttcatacaattatgtttgaattcact |
38325483 |
T |
 |
| Q |
291 |
aggttaaactgtattcaattttttggcatgtaatccct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325484 |
aggttaaactgtattcaattttttggcatgtaatccct |
38325521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 38324451 - 38324479
Alignment:
| Q |
1 |
tctgtatcaatgtaagtttctttgctgcc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38324451 |
tctgtatcaatgtaagtttctttgctgcc |
38324479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University