View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_high_33 (Length: 315)
Name: NF11500_high_33
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 14 - 298
Target Start/End: Complemental strand, 53006005 - 53005707
Alignment:
| Q |
14 |
gaagttatgattgataagaaatgagattataataaggtacggtgttcatagaaggttgctcggaatgat--------------cagtaagcaattgacta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53006005 |
gaagttatgattgataagaaatgagattataataaggtacggtgttcatagaaggttgctcggaatgataacataacagagatcagtaagcaattgacta |
53005906 |
T |
 |
| Q |
100 |
tactaagatgtcaaatagcgtcctgttcagcattaagtgacaaagtttagcagcaaatattatgtgcactgtaactacatggtttaacggtcaccaaact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53005905 |
tactaagatgtcaaatagcgtcctgttcagcattaagtgacaaagtttagcagcaaatactatgtgcactgtaactacatggtttaacggtcaccaaact |
53005806 |
T |
 |
| Q |
200 |
tcaaaacagaagctgaactgattgcataattaacatagtttccaagcatttagtagatacaatgagttgcagtgtaaggttttaatctgatgcttcttc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53005805 |
tcaaaacagaagctgaactgattgcataattaacatagtttccaagcatttagtagatacaatgagttgcagtgtaaggttttaatctgatgcttcttc |
53005707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University