View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_high_36 (Length: 267)
Name: NF11500_high_36
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 8020329 - 8020568
Alignment:
| Q |
18 |
cataggaactctatgagtgttatgattaatttcttcacttgaagcaatctttgaagctttaactttttctttgtcatgattgttacacacttgattctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020329 |
cataggaactctatgagtgttatgattaatttcttcacttgaagcaatctttgaagctttaactttttctttgtcatgattgttacacacttgattctgt |
8020428 |
T |
|
| Q |
118 |
ctctttttctttgtttgtcaattattattgcaagatattatatgttttcagaaatatatagtgtagcagcctttaattaactaaagggccannnnnnnaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8020429 |
ctctttttctttgtttgtcaattattattgcaagatattatatgttttcagaaatatatagtgtagcagcctttaattaactaaagggccatttttttaa |
8020528 |
T |
|
| Q |
218 |
tgcaaacattttggataataaagtttacttaaggtttcat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020529 |
tgcaaacattttggataataaagtttacttaaggtttcat |
8020568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University