View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_high_47 (Length: 236)
Name: NF11500_high_47
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 97 - 224
Target Start/End: Original strand, 10795253 - 10795392
Alignment:
| Q |
97 |
taagaaacctccctcggcaaattgtcctccacccccatc------------atcatcatcaccatatgtatacatgactggaccgccggggaatctgtat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10795253 |
taagaaacctccctcggcaaattgtcctccaccaccatcatcaccatcatcatcatcatcaccatatgtatacatgactggaccgccggggaacctgtat |
10795352 |
T |
 |
| Q |
185 |
ccagttgatgtgactttcagtggatcaggagcaaccccca |
224 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10795353 |
ccagttgatgtgaatttcagtggatcaggagcaaccccca |
10795392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University