View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11500_high_51 (Length: 220)

Name: NF11500_high_51
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11500_high_51
NF11500_high_51
[»] chr4 (1 HSPs)
chr4 (20-204)||(51929907-51930091)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 51930091 - 51929907
Alignment:
20 agaccgattaaagtgaagattatgagcgatatgatatgcatgacataaactaaactccacatttcggcgctatgtgaattgttgcgcgcagaaatcttga 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
51930091 agaccgattaaagtgaagattatgagcgatatgatatgcatgacataaactaaactccacatctcggcgctatgtgaattgttgcgcgcagaaatcttga 51929992  T
120 ataatactaccttgagagtctctatgcaatatatccttcgaaagttggaaaaccaatccttttttgtaggcatcatcgatcaata 204  Q
    |||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| || |||||||||||||||    
51929991 ataagactaccttgagagtctctatgcaatatatcattcgaaagctggaaaaccaatccttttttgcagacatcatcgatcaata 51929907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University