View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_low_10 (Length: 518)
Name: NF11500_low_10
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_low_10 |
 |  |
|
| [»] scaffold0059 (4 HSPs) |
 |  |  |
|
| [»] scaffold0013 (2 HSPs) |
 |  |  |
|
| [»] scaffold0212 (1 HSPs) |
 |  |  |
|
| [»] scaffold0082 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0059 (Bit Score: 51; Significance: 5e-20; HSPs: 4)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 317 - 406
Target Start/End: Original strand, 228 - 315
Alignment:
| Q |
317 |
aattggtgttcctccctctttctctatgtttttcgctctagagtaagtgattgatcccagatgaaatgtcacaaaagctatttataccat |
406 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||| ||||||||||||||||||||||||| |||||||| || ||||||| |||||||| |
|
|
| T |
228 |
aattggtgttccttcctatttctctctgtttttcactctagagtaagtgattgatcccagctgaaatgtaac--aagctatgtataccat |
315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 317 - 403
Target Start/End: Original strand, 6271 - 6357
Alignment:
| Q |
317 |
aattggtgttcctccctctttctctatgtttttcgctctagagtaagtgattgatcccagatgaaatgtcacaaaagctatttatac |
403 |
Q |
| |
|
||||| ||||||| ||||||||||| | |||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
6271 |
aattgatgttccttcctctttctctctactttttgctctagagtaagtgattgatcccagctgaaatgcaacaaaagctatttatac |
6357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 24 - 75
Target Start/End: Original strand, 170 - 221
Alignment:
| Q |
24 |
tttgccatcaagccttgatttctcaagaaatgctgttaatccaccttcaatc |
75 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
170 |
tttgccatcaatccttgatttctcaagaaatgttgttaatccaccttcaatc |
221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 12 - 75
Target Start/End: Original strand, 6201 - 6264
Alignment:
| Q |
12 |
gagatgaattcatttgccatcaagccttgatttctcaagaaatgctgttaatccaccttcaatc |
75 |
Q |
| |
|
|||||||||| ||||| ||| | ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
6201 |
gagatgaattggtttgctatccatccttgatttatcaagaaatgttgttaatccaccttcaatc |
6264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 317 - 403
Target Start/End: Complemental strand, 239129 - 239043
Alignment:
| Q |
317 |
aattggtgttcctccctctttctctatgtttttcgctctagagtaagtgattgatcccagatgaaatgtcacaaaagctatttatac |
403 |
Q |
| |
|
||||| ||||||| ||||||||||| | |||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
239129 |
aattgatgttccttcctctttctctctactttttgctctagagtaagtgattgatcccagctgaaatgcaacaaaagctatttatac |
239043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 12 - 75
Target Start/End: Complemental strand, 239199 - 239136
Alignment:
| Q |
12 |
gagatgaattcatttgccatcaagccttgatttctcaagaaatgctgttaatccaccttcaatc |
75 |
Q |
| |
|
|||||||||| ||||| ||| | ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
239199 |
gagatgaattggtttgctatccatccttgatttatcaagaaatgttgttaatccaccttcaatc |
239136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 83 - 133
Target Start/End: Complemental strand, 5180299 - 5180249
Alignment:
| Q |
83 |
aaccagcacctctgggatcaaaatacaggcccagcgaactacctttcattc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5180299 |
aaccagcacctctgggatcaaaatacaggcccagcgaactacctttcattc |
5180249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 412 - 501
Target Start/End: Complemental strand, 2508203 - 2508115
Alignment:
| Q |
412 |
ctgctcgcttaaccacgcccaggctcgcttagcgaccaaagctttcttcaccagtgggattctgccacatcagcaaagtggccctcaaac |
501 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||| | |||||||||| ||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
2508203 |
ctgcttgcttagccacgcccaggctcgcttggcgagcgaagctttctttaccagtggg-ttgtgccacgtcagcaaagtggccctaaaac |
2508115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 450 - 502
Target Start/End: Original strand, 28577863 - 28577915
Alignment:
| Q |
450 |
aagctttcttcaccagtgggattctgccacatcagcaaagtggccctcaaacc |
502 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28577863 |
aagctttcttcaccaatgggtttctgccacatcagcaaagtggccctcaaacc |
28577915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 2508362 - 2508306
Alignment:
| Q |
24 |
tttgccatcaagccttgatttctcaagaaatgctgttaatccaccttcaatctttac |
80 |
Q |
| |
|
||||||||||||||||||||| |||| ||| | |||||||||||||||| ||||||| |
|
|
| T |
2508362 |
tttgccatcaagccttgatttgtcaaaaaaagttgttaatccaccttcagtctttac |
2508306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0212 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 278 - 318
Target Start/End: Complemental strand, 15805 - 15765
Alignment:
| Q |
278 |
aacgctcaactgtggcacaattagctcaaattctttcagaa |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15805 |
aacgctcaactgtggcacaattagttcaaattctttcagaa |
15765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 70
Target Start/End: Complemental strand, 31848973 - 31848917
Alignment:
| Q |
14 |
gatgaattcatttgccatcaagccttgatttctcaagaaatgctgttaatccacctt |
70 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| |||||||| | |||||||||||| |
|
|
| T |
31848973 |
gatgaattaatttgccatcaagccatgatttcttaagaaatgtttttaatccacctt |
31848917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 278 - 315
Target Start/End: Complemental strand, 44194051 - 44194014
Alignment:
| Q |
278 |
aacgctcaactgtggcacaattagctcaaattctttca |
315 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
44194051 |
aacgctcaactgtggcacaattagttcaaatcctttca |
44194014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 458 - 495
Target Start/End: Original strand, 13391782 - 13391819
Alignment:
| Q |
458 |
ttcaccagtgggattctgccacatcagcaaagtggccc |
495 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13391782 |
ttcaccagtgggtttctgccacatcagcaaagtggccc |
13391819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 29376 - 29408
Alignment:
| Q |
171 |
gatcgagacgggaacagaactgaaagcaagtag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29376 |
gatcgagacgggaacagaactgaaagcaagtag |
29408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 134 - 170
Target Start/End: Complemental strand, 55145 - 55109
Alignment:
| Q |
134 |
aatctttctgccgtgtgctctttttactattctttcg |
170 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
55145 |
aatctttctgcggtgtgctctgtttactattctttcg |
55109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 282 - 318
Target Start/End: Original strand, 36499491 - 36499527
Alignment:
| Q |
282 |
ctcaactgtggcacaattagctcaaattctttcagaa |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36499491 |
ctcaactgtggcacaattagttcaaattctttcagaa |
36499527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 98 - 133
Target Start/End: Original strand, 30066548 - 30066583
Alignment:
| Q |
98 |
gatcaaaatacaggcccagcgaactacctttcattc |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30066548 |
gatcaaaatacaggcccagtgaactacctttcattc |
30066583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 134 - 170
Target Start/End: Original strand, 55965 - 56001
Alignment:
| Q |
134 |
aatctttctgccgtgtgctctttttactattctttcg |
170 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
55965 |
aatctttctgcggtgtgctctgtttactattctttcg |
56001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 171 - 203
Target Start/End: Complemental strand, 5085756 - 5085724
Alignment:
| Q |
171 |
gatcgagacgggaacagaactgaaagcaagtag |
203 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
5085756 |
gatcgaaacgggaacagaactgaaagcaagtag |
5085724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University