View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11500_low_22 (Length: 411)

Name: NF11500_low_22
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11500_low_22
NF11500_low_22
[»] chr2 (1 HSPs)
chr2 (3-73)||(21947585-21947655)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 3 - 73
Target Start/End: Original strand, 21947585 - 21947655
Alignment:
3 aattttgaagtagaagcgtaatggaccaacaggaaaataatttctaggaaatcaatcaaatgcataagtag 73  Q
    |||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||    
21947585 aattttcaagtagaagcgtaatggaccagcagaaaaataatttctaggaaatcaatcaaatgcataagtag 21947655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University