View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_low_43 (Length: 242)
Name: NF11500_low_43
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 31924720 - 31924936
Alignment:
| Q |
1 |
atgtttaaatttcaaacattgaacaccttatttaggaactaactttaaacaatatataggaaaattttgccacatgacttgcaggagggtgtattggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924720 |
atgtttaaatttcaaacattgaacaccttatttaggaactaactttaaacaatatacaggaaaattttgccacatgacttgcaggagggtgtattggaag |
31924819 |
T |
 |
| Q |
101 |
ctatagctattcaagcactaggccaggtacttgttgatcaatctctagattaacttatgaaagcagttaattcttctagtccattttgtttattgataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924820 |
ctatagctattcaagcactaggccaggtacttgttgatcaatctatagattaacttatgaaagcagttaattcttctagtccattttgtttattgataaa |
31924919 |
T |
 |
| Q |
201 |
attttcatattcaaata |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31924920 |
attttcatattcaaata |
31924936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University