View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_low_44 (Length: 242)
Name: NF11500_low_44
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 43121446 - 43121663
Alignment:
| Q |
1 |
aaactaatcctaggttgttattataataagtggggatttggttatgacaaattttgtacagctaatgtcgttgaatttgttcttaactaattgttgagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43121446 |
aaactaatcctaggttgttattataataagtgaggatttggttatgacaaattttgtacagctaatgtcgttgaatttgttcttaactaattgttgagac |
43121545 |
T |
 |
| Q |
101 |
aaataaagaaaacaaacaagaaatgatgcttttaacaatattgtgacagccaagttttagcttcttgaaaatagatttgatggaatcacttaattatttt |
200 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43121546 |
aaataaagaaaataaacgagaaatgatgcttttaacaatattgtgacagccaagttttagcttcttgaaaatagatttgatggaatcagttaattatttt |
43121645 |
T |
 |
| Q |
201 |
agcaagaaatttcaaaat |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43121646 |
agcaagaaatttcaaaat |
43121663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University