View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_low_50 (Length: 237)
Name: NF11500_low_50
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 21 - 153
Target Start/End: Complemental strand, 4117951 - 4117819
Alignment:
| Q |
21 |
cattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117951 |
cattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcac |
4117852 |
T |
|
| Q |
121 |
cacagcatccagtatcctaccattgtttaactg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4117851 |
cacagcatccagtatcctaccattgtttaactg |
4117819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 21 - 156
Target Start/End: Complemental strand, 21157256 - 21157121
Alignment:
| Q |
21 |
cattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21157256 |
cattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgtgaagtgatggctcat |
21157157 |
T |
|
| Q |
121 |
cacagcatccagtatcctaccattgtttaactggta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21157156 |
cacagcatccagtatcctaccattgtttaactggta |
21157121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University