View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11500_low_56 (Length: 220)
Name: NF11500_low_56
Description: NF11500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11500_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 51930091 - 51929907
Alignment:
| Q |
20 |
agaccgattaaagtgaagattatgagcgatatgatatgcatgacataaactaaactccacatttcggcgctatgtgaattgttgcgcgcagaaatcttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51930091 |
agaccgattaaagtgaagattatgagcgatatgatatgcatgacataaactaaactccacatctcggcgctatgtgaattgttgcgcgcagaaatcttga |
51929992 |
T |
 |
| Q |
120 |
ataatactaccttgagagtctctatgcaatatatccttcgaaagttggaaaaccaatccttttttgtaggcatcatcgatcaata |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
51929991 |
ataagactaccttgagagtctctatgcaatatatcattcgaaagctggaaaaccaatccttttttgcagacatcatcgatcaata |
51929907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University