View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11501_high_22 (Length: 280)
Name: NF11501_high_22
Description: NF11501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11501_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 42483808 - 42483541
Alignment:
| Q |
1 |
cccttttcagcaagaacagcgatatcagggctatcatcattatgattatcgttgatctctttctccaacgaaagctttgatagagaatcagatgggtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42483808 |
cccttttcagcaagaacagcgatatcagggctatcatcattatgattatcgtcgatctctttctccaacgaaagctttgatagagaatcagatgggtcat |
42483709 |
T |
|
| Q |
101 |
cgaaatctaagatgaagcattcttcagtttcctcgaaacgtttgatgtcttcttttcttttgagacaaaccactgctctaattggggtttccgacattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42483708 |
cgaaatctaagatgaagcattcttcagtttcctcgaaacgtttgatgtcttcttttcttttgagacaaaccactgctctaattggggtttccgacattgg |
42483609 |
T |
|
| Q |
201 |
tgtagaaaggtctatgctttcgttgttacagtctttctcttctgccattgttttccacttcttcttct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42483608 |
tgtagaaaggtctatgctttcgttgttacagtctttctcttctgccattgttttccacttcttcttct |
42483541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 42491565 - 42491521
Alignment:
| Q |
124 |
tcagtttcctcgaaacgtttgatgtcttcttttcttttgagacaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||||| |
|
|
| T |
42491565 |
tcagtttcctcgaaacgtttgatgtcgtcgatttttttgagacaa |
42491521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University