View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11501_high_28 (Length: 227)
Name: NF11501_high_28
Description: NF11501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11501_high_28 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 9374197 - 9373971
Alignment:
| Q |
1 |
ttcggctatatgcctcttgatttttgtaagaaatgatcatgatcattgaattttcttcctttagatgatttttaaaccaattcagccgtaatatattact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9374197 |
ttcggctatatgcctcttgatttttgtaagaaatgatcatgatcattgaattttcttcctttagataatttttaaaccaattcagccgtaatatattact |
9374098 |
T |
 |
| Q |
101 |
tcatacccttgtagtggaaaaatgatgataaggaataaaagttgccgttccatctttaaaggattgtgtttcttgacttcacttcaatttgatatatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9374097 |
tcatacccttgtagtggaaaaatgatgataaggaataatagttgccgttccatctttaaaggattgtgtttcttgacttcacttcaatttgatatatggt |
9373998 |
T |
 |
| Q |
201 |
atcattgattggtgacaaaggaactaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9373997 |
atcattgattggtgacaaaggaactaa |
9373971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University