View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11501_low_16 (Length: 334)
Name: NF11501_low_16
Description: NF11501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11501_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 15507090 - 15506887
Alignment:
| Q |
1 |
gtggaaataagaacaaaacaagacatgcctgaaagaggcaagaaatgaactttgtttgctggatttccatcatgtctttcatatgatctttggtcaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15507090 |
gtggaaataagaacaaaacaagacatgcttgaaagaggaatgaaatgaactttgtttgctggattcccatcatgtctttcatatgatctttggtcaactc |
15506991 |
T |
|
| Q |
101 |
aatctccaattaatactagtggagatttaaggctgcaatactagagcatttcaagtattgaatgtgcctcccataaagtactcttcaaggggcttatcat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15506990 |
aatctccaattaatactggtggagatttaaggctgcaacactagagcatttcaagtattgaatgtgcctcccataaagtactcttcaaggggcttatcat |
15506891 |
T |
|
| Q |
201 |
tttg |
204 |
Q |
| |
|
|||| |
|
|
| T |
15506890 |
tttg |
15506887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 228 - 316
Target Start/End: Complemental strand, 15506861 - 15506773
Alignment:
| Q |
228 |
tgttatatcagtgtgtgagagggttgtactatgaagtgagcactcttatctttattgtcagagagagcaactaaatagttgtcacaagt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15506861 |
tgttatatcagtgtgtgagagggttgtactatgaagtgagcactcttatctttattgtcagagagagcaactaaatagttgtcacaagt |
15506773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University