View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11501_low_31 (Length: 220)
Name: NF11501_low_31
Description: NF11501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11501_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 29536466 - 29536265
Alignment:
| Q |
18 |
gttagaaatttcgcgcaggtagtgaagaaagaatacttgtttgttgagtagtgacaaacaaaaaaggttaccgccttcgagaatacttgtttaactttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29536466 |
gttagaaatttcgcgcaggtagtgaagaaagaatacttgtttgttgagtagtgacaaacaaaaaaggttaccgccttcgagaatacttgtttaactttta |
29536367 |
T |
 |
| Q |
118 |
acccaactataagagtaatgaaga---------------agaataaggatccactgcaagtttcatggctaatctacaattctcctcgttttcgaccacc |
202 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29536366 |
acccaactataagaggaatgaagaagaagaagaagaagaagaataaggatccactgcaagtttcatggctaatctacaatcctcctcgttttcgaccacc |
29536267 |
T |
 |
| Q |
203 |
ta |
204 |
Q |
| |
|
|| |
|
|
| T |
29536266 |
ta |
29536265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University