View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11502_low_4 (Length: 354)
Name: NF11502_low_4
Description: NF11502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11502_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 11 - 354
Target Start/End: Original strand, 51893041 - 51893386
Alignment:
| Q |
11 |
cagagaaataaagcgttggagcatattgaacatcataaacttgatgggattgtttactttgctgatgatgataatgtgtattctcttgacttgtttcaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51893041 |
cagagaaataaagcgttggagcatattgaacatcataaacttgatgggattgtttactttgctgatgatgataatgtgtattctcttgacttgtttcaga |
51893140 |
T |
|
| Q |
111 |
caatcagagatatcaggtacatattttgttacttccttttgtgttatacctactttatcagtattattattctgtttttcctttgaatttatacttaatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51893141 |
caatcagagatatcaggtacatattttgttacttccttttgtgttatacctactttatcagtattattattctgtttttcctttgaatttatacttagtt |
51893240 |
T |
|
| Q |
211 |
tgagtttttcctgatgatgataaagtgatgggtttgca--tctgattaatcttaaagttatattgcttgttttggaggtgtggttgttgtaattgtagta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51893241 |
tgagtttttcctgatgatgataaagtgatgggtttgcatctctgattaatcttaaagttatattgcttgttttggaggtatggttgttgtaattgtagta |
51893340 |
T |
|
| Q |
309 |
tgaatttgtttgccttttgttcgttggcttttggtaatctcgagtt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51893341 |
tgaatttgtttgccttttgttcgttggcttttggtaatctcgagtt |
51893386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University