View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11503_high_7 (Length: 233)
Name: NF11503_high_7
Description: NF11503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11503_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 7364352 - 7364590
Alignment:
| Q |
1 |
gtaaatgggtggctgaaatccgcgaacctaatcgtggtgctcgtctttggcttggtacttttgaaacctctcatgaagctgctttagcttatgatgctgc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364352 |
gtaaatgggtggctgaaattcgcgaacctaatcgtggtgctcgtctttggcttggtacttttgaaacctctcatgaagctgctttagcttatgatgctgc |
7364451 |
T |
 |
| Q |
101 |
tgctcgtaaactttatggttctgatgcaaaacttaacctcccagaactttctacaccccctcaaaatactacttcatcaccctctcctacaccacctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364452 |
tgctcgtaaactttatggttctgatgcaaaacttaacctcccagaactttctacaccccctcaaaatactacttcatcaccctctcctacaccacctcaa |
7364551 |
T |
 |
| Q |
201 |
atg------caacaacaacatcctcatattcaaattcaa |
233 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
7364552 |
atgcaacaacaacaacaacatcctcatattcaaattcaa |
7364590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 52690559 - 52690676
Alignment:
| Q |
1 |
gtaaatgggtggctgaaatccgcgaacctaatcgtggtgctcgtctttggcttggtacttttgaaacctctcatgaagctgctttagcttatgatgctgc |
100 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||| |||| ||||||||||| || ||||| || || | |||||||||||| |||||||||||||| |
|
|
| T |
52690559 |
gtaaatgggttgctgaaatccgtgaacccaatcgtggttctcgcctttggcttgggacatttgagacatcccttgaagctgctttggcttatgatgctgc |
52690658 |
T |
 |
| Q |
101 |
tgctcgtaaactttatgg |
118 |
Q |
| |
|
|| | ||| |||||||| |
|
|
| T |
52690659 |
cgcacttaagctttatgg |
52690676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University