View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11504_low_4 (Length: 371)
Name: NF11504_low_4
Description: NF11504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11504_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 25657603 - 25657884
Alignment:
| Q |
1 |
agtaaccaccgcggaaggaggccgctcaaacatctctctcaatctaaccaacatagacgtgaacacatggaacacattttaaaacgaaaccaccaaatct |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
25657603 |
agtaaccaccgcggaaggaggtcgctcaaacatctctctcaatctaaccaacacagacgtgaacacatggaacacgttttaaaacaaaaccaccgaatct |
25657702 |
T |
|
| Q |
101 |
ttgatagatccgattttgagatacctaattaaacaatcctccaagaggaaggcaacatcagctttttaaaccgagcaacataaatggacatgccaacatc |
200 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25657703 |
ttgatagatccggttttgagatacccaattaaacaatcctccaagaggaaggcaacgtcagctttttaaaccgagcaacataaatcgacatgccaacatc |
25657802 |
T |
|
| Q |
201 |
cagatctaacgagaggacgactagccatggagttttaagaagcacaaaacataccgcggctgttgctttcacccacagttgc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
25657803 |
cagatctaacgagaggacgactagccatggagttttaagaatcacaaaacataccgcgactgttgctttcaccgacagttgc |
25657884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University