View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11505_high_3 (Length: 260)
Name: NF11505_high_3
Description: NF11505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11505_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 35835113 - 35835317
Alignment:
| Q |
1 |
aagcgtacatgagttcctgcattgtagtggctttctcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835113 |
aagcgtacatgagttcctgcattgtagtggctttctcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaac |
35835212 |
T |
 |
| Q |
101 |
atcgtggactcgaattggaacttgttcggaggctaatcgacgggaaaatgtttctactttgaaacgttgattgcgtagttttgattttagggtttgttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835213 |
atcgtggactcgaattggaacttgttcggaggctaatcgacgggaaaatgtttctactttgaaacgttgattgcgtagttttgattttagggtttgttga |
35835312 |
T |
 |
| Q |
201 |
tttgg |
205 |
Q |
| |
|
||||| |
|
|
| T |
35835313 |
tttgg |
35835317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 32053136 - 32053222
Alignment:
| Q |
36 |
tcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaacatcgtggactcgaattggaact |
122 |
Q |
| |
|
|||||||| | ||||||||||||||| | ||||||||||||||| ||||| ||| || | || ||||||||||| ||||||||| |
|
|
| T |
32053136 |
tcgattcccttgagttcagcttcgatcacccaatctttggttttcgtgttgccgcgaattatcacgtcgtggactcggattggaact |
32053222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University