View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11505_low_3 (Length: 260)

Name: NF11505_low_3
Description: NF11505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11505_low_3
NF11505_low_3
[»] chr5 (1 HSPs)
chr5 (1-205)||(35835113-35835317)
[»] chr3 (1 HSPs)
chr3 (36-122)||(32053136-32053222)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 35835113 - 35835317
Alignment:
1 aagcgtacatgagttcctgcattgtagtggctttctcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35835113 aagcgtacatgagttcctgcattgtagtggctttctcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaac 35835212  T
101 atcgtggactcgaattggaacttgttcggaggctaatcgacgggaaaatgtttctactttgaaacgttgattgcgtagttttgattttagggtttgttga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35835213 atcgtggactcgaattggaacttgttcggaggctaatcgacgggaaaatgtttctactttgaaacgttgattgcgtagttttgattttagggtttgttga 35835312  T
201 tttgg 205  Q
    |||||    
35835313 tttgg 35835317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 32053136 - 32053222
Alignment:
36 tcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaacatcgtggactcgaattggaact 122  Q
    |||||||| | ||||||||||||||| | ||||||||||||||| ||||| |||   || |  || ||||||||||| |||||||||    
32053136 tcgattcccttgagttcagcttcgatcacccaatctttggttttcgtgttgccgcgaattatcacgtcgtggactcggattggaact 32053222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University