View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11505_low_5 (Length: 222)
Name: NF11505_low_5
Description: NF11505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11505_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 147
Target Start/End: Complemental strand, 11857321 - 11857199
Alignment:
| Q |
19 |
atcacacatttctcacttcttttatgtttttctttctttgaattaaattaacataattacatttgcaatgcatttcaattcaattattggttcaagcagc |
118 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||| | ||||| |
|
|
| T |
11857321 |
atcacacatttctcatttcttt-atgtttttctttctttgaattaaattaacataattccatttgca-----ttttaattcaattattggtttatgcagc |
11857228 |
T |
|
| Q |
119 |
atgttgaagttccggttccaattccaaag |
147 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
11857227 |
atgttgaagttcctgttccaattccaaag |
11857199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 143 - 201
Target Start/End: Complemental strand, 11857138 - 11857080
Alignment:
| Q |
143 |
caaagcggtcttcttcgccctttattgccacgaaaatttcccttcattccttgtatgat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11857138 |
caaagcggtcttcttcgccctttattgccacgaaaatttcccttcattccttgtatgat |
11857080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 92 - 147
Target Start/End: Complemental strand, 11802948 - 11802893
Alignment:
| Q |
92 |
ttcaattcaattattggttcaagcagcatgttgaagttccggttccaattccaaag |
147 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| ||||||| |
|
|
| T |
11802948 |
ttcaattcaattattggtttaagcagcatgttgaagttcctattccaactccaaag |
11802893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 11431447 - 11431395
Alignment:
| Q |
149 |
ggtcttcttcgccctttattgccacgaaaatttcccttcattccttgtatgat |
201 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
11431447 |
ggtcttcttcgctatttattgcctcgaaaatttcccttcactccttgtatgat |
11431395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 11564019 - 11564071
Alignment:
| Q |
149 |
ggtcttcttcgccctttattgccacgaaaatttcccttcattccttgtatgat |
201 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
11564019 |
ggtcttcttcgctatttattgcctcgaaaatttcccttcactccttgtatgat |
11564071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University