View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11506_high_8 (Length: 238)
Name: NF11506_high_8
Description: NF11506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11506_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 50445907 - 50445843
Alignment:
| Q |
1 |
cattctttgggacattctcttcatattttggatcttaattctcgtatcatttactggtaataatg |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50445907 |
cattctttgggacattctcttcatattttggatcttaattctcgtatcatttactggtaataatg |
50445843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 167 - 225
Target Start/End: Complemental strand, 50445745 - 50445687
Alignment:
| Q |
167 |
tgagatataatgtattagattcttagttttaaattgcggtctacattgtatttgaattt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50445745 |
tgagatataatgtattagattcttagttttaaattgcagtctacattgtatttgaattt |
50445687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University